GeneFISH – combined detection of genes and rRNA in microorganisms

B2. Gene hybridization

When you are using this protocol, please cite:

Moraru, C., Lam, P., Fuchs, B.M., Kuypers, M.M.M. and Amann, R. (2010) GeneFISH – an in situ technique for linking gene presence and cell identity in environmental microorganisms. Environ. Microbiol. 12: 3057-3073.

Introduction to geneFISH

A. Sample preparation

A1. Sample fixation

A2. Sample immobilization

A3. Embeding in agaroze

A4. Permeabilization

A5. Inactivation of endogeous peroxidases

B. gene detection

B1. gene probes

B1.1. probe design

B1.2 probe synthesis

B1.3 determination of hybridization conditions for hybridization and washing

B2. gene hybridization

B3. antibody binding

B4. gene CARD and inactivation of HRPs from the gene detection step

C. rRNA detection

C1. rRNA hybridization

C2. rRNA CARD

D. Mounting for microscopy and counterstaining

E. Microscopy

F. List of materials

B2. Gene hybridization

            For gene hybridization, beside the polynucleotide probes specific for the gene of interest, a negative control probe has to be used (NonPolyPr350). Alternatively, DNase digestion can be performed, to remove the target genes and create a negative control, or, when working on pure cultures or enrichments, an culture without the target gene can be used as negative control.

NonPolyPr350: the negative control probe for gene detection.

            NonPolyPr350 can be synthesized from a larger template, named NonPolyPr (GenBank accession number GU583840). NonPolyPr was designed not to give any significant Blast hits with the nucleotide datasets for microorganisms (Bacteria and Archaea). The sequence was synthesized by the BlueHeron company, introduced into a pUCminusMCS vector and further transformed into E. coli cells. The NonPolyPr template has a T7 RNA polymerase promoter and multiple restriction sites (see below), so that it can be transcribed in vitro into RNA probes of different sizes. Alternatively, primers can be designed to synthesize dsDNA probes of different sizes. NonPolyPr350 is a Dig labeled dsDNA, 350 bp in length and PCR synthesized using the following primes: NonPolyPr350-F (5’-ACAGTCGAATGTCTACCTAC-3’) and NonPolyPr350-R (5’-AATATTGTGCAGTCGGATC-3’).

> NonPolyPr sequence. In bold, lower caps, the T7 RNA polymerase promoter.

GTTTAAACgccagtgaattgtaatacgactcactatagggACAGTCGAATGTCTACCTACACAGTCGATCTGGTCCACAGTCGAATGTCTACCTCG

ACAGTTGATCTGACAGACTGTCTGACAGTCGAATGTCTACCCAGCTGACAGTCGATCTGTGTAACAATCTATCCGACTACATGACTGA

CTATTTAAATACAATCGATCCGACAGTCGATCTGGTGAACAATCGATCCGACTTTATAAACAGTCGATCTGCATGACAGTCGATCTAG

CTGACAGTCGATCTGCACGTCACAGTCGATCAAACAGTTGATCTGACAGACTGGACAGTCGATCTCCGCTCACAGTCGATCTGTGAC

AGTCGATCTACAATCGATCCGACTGCACAATATTACTGACGACTGACTACAGTCGAATGTCTACCAGACTGACTGTACGTTAAC

Composition of the gene hybridization buffer

            The hybridization buffer has a high salt concentration (1718 mM Na⁺, see supplementary Table 2) and 10% dextran sulfate, to promote high hybridization rates. Blocking reagents (sheared salmon sperm DNA, yeast RNA, protein-based blocking reagent) are included to minimize unspecific probe binding to different surfaces. Sodium dodecyl sulfate (SDS) is added as a denaturant, to help remove proteins from the chromosomal DNA and to facilitate probe diffusion by permeabilizing the cell walls. Ethylenediaminetetraacetic acid disodium dihydrate (EDTA) is added to chelate divalent cations, both to inactivate contaminant DNases and to control the stringency of hybridization. Formamide is used in order to decrease the temperature at which nucleic acids hybridize, since high temperatures are detrimental for cell integrity and morphology.

Procedure

Preparation of hybridization buffer

Table 3: gene hybridization buffer with 35% Formamide

component	Volume	Final concentration
100% Formamide (FA)	14 ml	35%
20x SSC	10 ml	5x
Dextran sulfate (powder)	4 g	10%
20% SDS	200 µl	0.1%
0.5 M EDTA	1.6 ml	20 mM
miliQW	4.4 ml
sheared salmon sperm DNA (10 mg/ml)	1 ml	0.25 mg/ml
Yeast RNA (10 mg/ml)	1 ml	0.25 mg/ml
10% blocking reagent for nucleic acids	4 ml	1%
Final volume	40 ml

In a 50 ml Falcon tube add all except formamide, SDS and blocking reagents (sheared salmon sperm DNA, yeast RNA, blocking reagent for nucleic acids)
Shake well to dissolve the dextran sulfate
1 h at 48°C
Add the rest
Vortex, spin down
Aliquot and store at -20°C

Hybridization in glass hybridization chambers

Filters are placed in Petri Dishes and covered with Hybridization buffer. The Petri Dishes are then placed in hybridization chambers (O-ring sealed lunch boxes, with the bottom part from glass and the lid from polypropylene) which are padded with KimWipes soaked in 35% FA solution, to keep a humid atmosphere during the incubation.

Prehybridization

Add the filters face up in Petri Dishes (PDs)

Cover filters with hybridization buffer (35% FA), volume depending on the size of the filter (40 µl per 1/8 of 25 mm filter)

Place PDs in hybridization chambers

Incubate for 1-3 h at 46°C

Denaturation and Hybridization

In new PDs place droplets of hybridization mix (hybridization buffer and probe) (double the amount compared with the prehybridization)

Transfer the filters face down into the hybridization mix

Place PDs in hybridization chambers

Denature for 1 h at 85°C

For hybridization, quickly transfer the hybridization chamber to 46°C and incubate over night

Hybridization mix: gene hybridization buffer with 5 pg/µl probe (1:1000 dilution from a 5 ng/µl stock)

Washing

2 x 10 min wash in WBI (prewarmed at 46°C)

3 x quick wash in WBII (prewarmed at 46°C)

transfer in new WBII (50 ml Falcons)

Incubate 1.5 h at 46°C, water bath, shaking.

Quick 1x PBS wash

Table 4: Washing buffer I for gene detection (WBI)

component	volume	concentration
20x SSC	5 ml	2x SSC
20% SDS	250 µl	0.1% SDS
miliQW	Up to 50 ml

Table 5: Washing buffer II for gene detection (WBII)

component	volume	concentration
20x SSC	250 µl	0.1x SSC
20% SDS	250 µl	0.1% SDS
miliQW	Up to 50 ml

Home CV Contact